View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_224 (Length: 207)
Name: NF1126_low_224
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_224 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 44016964 - 44016769
Alignment:
| Q |
1 |
caccatgttcatggaaaggcataaattgttcaccacaatatagagtgatttccctttatatccctgatactttcctcaacctcacttctttaccatctca |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016964 |
caccatgttcatggaaaggcataacttgttcaccacaatctagagtgatttccctttctatccctgatactttcctcaacctcacttctttaccatctca |
44016865 |
T |
 |
| Q |
101 |
actatcctctttaacaatgcttcagcttcttaatctctcttcaaccaatctctctggctctatcccaccttcttttggtcaactctcccatcttca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016864 |
actatcctctttaacaatgcttcagcttcttaatctctcttcaaccaatctctctggctctatcccaccttcttttggtcaactctcccatcttca |
44016769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University