View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_232 (Length: 201)
Name: NF1126_low_232
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_232 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 68 - 201
Target Start/End: Complemental strand, 43327317 - 43327178
Alignment:
| Q |
68 |
ggcagatgggatggaagaggacagtacaacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327317 |
ggcagatgggatggaagaggacagtacaacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaa |
43327218 |
T |
 |
| Q |
168 |
aatcaa------aatcttgatgatgtatgtttggtggtgg |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |
|
|
| T |
43327217 |
aatcaaaatcaaaatcttgatgatgtatgtttggttgtgg |
43327178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University