View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_36 (Length: 489)
Name: NF1126_low_36
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 8446516 - 8446166
Alignment:
| Q |
1 |
ctttctatgcattttataatatttttcactttctatcgtgattgttgacatggctccttttctttatttgtatgatgaacattttgattcgagtgatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8446516 |
ctttctatgcattttataatatttttcaatttctatcgtgattgttgacatggctccttttctttatttgtatgatgaacattttgattcgagtgattta |
8446417 |
T |
|
| Q |
101 |
ggatgctaaattgttaagctttgattctaaattttgattatcttgaaaaatgtcacttggcctctagtgatctaggaagctaaattatggcacactagct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446416 |
ggatgctaaattgttaagctttgattctaaattttgattatcttgaaaaatgtca-----cctccagtgatctaggaagctaaattatggcacactagct |
8446322 |
T |
|
| Q |
201 |
attcctttggcataaaaactaatataatataatctaaagtggatttctaggggtacgaacataagagactaaagtatctaatttttgtaaattacaggg- |
299 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446321 |
attcctttggcataaaaactaatataatctaatctaaagtggatttctaggggtacgaacataagagactaaagtatctaatttttgtaaattacaggga |
8446222 |
T |
|
| Q |
300 |
----------tatgctctattgttctaatctttgtccctaactctttccctttgtaa |
346 |
Q |
| |
|
||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8446221 |
tcttcacctctattctctattgttctaatc-ttgtccctaactctttccctttgtaa |
8446166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 304 - 489
Target Start/End: Complemental strand, 8446141 - 8445955
Alignment:
| Q |
304 |
ctctattgttctaatctttgtccctaactctttccctttgtaatccctcaactgttttcttccccgtctccctttgatcttgtttctattgtgga-ttgg |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8446141 |
ctctattgttctaatctttgtccctaactctttccctttgtaatccctcaactgttttcttccccgtctccctttgatcttgtttctattgtggatttgg |
8446042 |
T |
|
| Q |
403 |
aatactctgtctcccaaaagcgacatcgcccctgcccatgccttattcaaacttgggaccatagcatacactagtggagttccaggg |
489 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446041 |
aatactctgtctcccaaaagcgacatcacccctgcccatgctttattcaaacttgggaccatagcatacactagtggagttccaggg |
8445955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University