View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_59 (Length: 441)
Name: NF1126_low_59
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 332 - 426
Target Start/End: Original strand, 42795642 - 42795736
Alignment:
| Q |
332 |
ctcaattattatataaataatgtcgtcatctgaataggaggtccgatgatttatgtttcaaacacaactcatgacccttctttgtaagtcttcat |
426 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42795642 |
ctcaattattatataaatagtgtcgtcatttgaataggaggtcagatgatttatgtttcaaacacaactcatgacccttctttgtaagtcttcat |
42795736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University