View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_59 (Length: 441)

Name: NF1126_low_59
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_59
NF1126_low_59
[»] chr5 (1 HSPs)
chr5 (332-426)||(42795642-42795736)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 332 - 426
Target Start/End: Original strand, 42795642 - 42795736
Alignment:
332 ctcaattattatataaataatgtcgtcatctgaataggaggtccgatgatttatgtttcaaacacaactcatgacccttctttgtaagtcttcat 426  Q
    ||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
42795642 ctcaattattatataaatagtgtcgtcatttgaataggaggtcagatgatttatgtttcaaacacaactcatgacccttctttgtaagtcttcat 42795736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University