View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_67 (Length: 427)
Name: NF1126_low_67
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 1e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 136 - 312
Target Start/End: Original strand, 9500605 - 9500781
Alignment:
| Q |
136 |
ctccacccttcagctaaagtgaaacttgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttgctacattgataaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9500605 |
ctccacccttcagctaaagtgaaacttgactaggttctagggtgtatggaagaccatagttgaattttctgttctccaacctatttgctacaatgataaa |
9500704 |
T |
|
| Q |
236 |
tactgtgtttggatgtatcactggcttgtcaattttattgcttgacaattaaaatatgattctacttcccacaggtt |
312 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9500705 |
tactatgtttggaagtatcactggcttgtcaattttattgcttgacaattaaaatatgattctacttcccataggtt |
9500781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University