View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_73 (Length: 414)
Name: NF1126_low_73
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 30 - 406
Target Start/End: Original strand, 31775739 - 31776117
Alignment:
| Q |
30 |
taaagagcaattgtctatcttttgcttatacactaaccctattcatataacctgcaagtttaagcgacccgattaaaagagattgactagcacagatacc |
129 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
31775739 |
taaagagcaattgtctatcttttgcgtatacactaaccctattcatataacctgcaagtttaagcgacccgattaaaagagattgactagcacggatatc |
31775838 |
T |
 |
| Q |
130 |
ctcgtacgtagcttaggttttattctcacaatattat---aacacacacgggtaagtctgtgttcaaggttctattattggttagcacattaaattaaaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31775839 |
ctcgtacgtagcttaggttttattctcacaatattattataacacacacgggtaagtctgtgttcaaggttctattattggttagcacattaaattaaaa |
31775938 |
T |
 |
| Q |
227 |
taaagtaacaagtgaaaaatcttatttttcccagaacatacatacattgatgcatttgtgccccccacaacttctcattttgtagcatgacacttggatt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31775939 |
taaagtaacaagtgaaaaatcttatttt-cccagaacatacatacattgatgcatttgtgccccccacaacttctcattttgtagcatgacacttggatt |
31776037 |
T |
 |
| Q |
327 |
ttttggtttgtcttcatatgttgtctttctgaaagcaatcttcctctcattatcaaactttgtcctacgaatcctatgct |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31776038 |
ttttggtttgtcttcatatgttgtctttctgaaagcaatcttcctctcattatcaaactctgtcctacgaatcctatgct |
31776117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University