View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_80 (Length: 394)
Name: NF1126_low_80
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_80 |
 | |
|
| [»] scaffold0505 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 165 - 382
Target Start/End: Original strand, 34620623 - 34620840
Alignment:
| Q |
165 |
gtagtaggaggccgtatgcaacaccattatatcgcggcattgacaaagcttgaacattgaggtggtggacataaattcaaaataataattatctttatcc |
264 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34620623 |
gtagtaggaggccgtacgtaacaccattatatcgcggcattgacaaagcttgaacattgaggtggtggacataaattcaaaataataattatctttatcc |
34620722 |
T |
|
| Q |
265 |
ttcagttggccgccaatgtcatggggggcaagggaaaaggaccttcacttaccaaaataacaatgatttccttttaaagtacttgtatcttgttctttta |
364 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34620723 |
ttcagttggccgccaatgccatggggggcaagggaaaaggaccttcacttaccaaaataacaatgatttccttttaaagtacttgtatcttgttctttta |
34620822 |
T |
|
| Q |
365 |
ttgtcctagctagatatt |
382 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34620823 |
ttgtcctagctagatatt |
34620840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0505 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0505
Description:
Target: scaffold0505; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 63
Target Start/End: Complemental strand, 9250 - 9216
Alignment:
| Q |
29 |
atggacatccaccaatattattattcataacaaaa |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9250 |
atggacatccaccaacattattattcataacaaaa |
9216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University