View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1126_low_90 (Length: 367)
Name: NF1126_low_90
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1126_low_90 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 13 - 271
Target Start/End: Original strand, 44016769 - 44017027
Alignment:
| Q |
13 |
tgaagatgggagagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016769 |
tgaagatgggagagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgag |
44016868 |
T |
 |
| Q |
113 |
atggtaaagaagtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016869 |
atggtaaagaagtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttga |
44016968 |
T |
 |
| Q |
213 |
tgttgaagggttccatgaagagagaatagaaggtgatgatgttgcaagagaaagaagtg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016969 |
tgttgaagggttccatgaagagagaatagaaggtgatgatgttgcaagagaaagaagtg |
44017027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University