View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_94 (Length: 357)

Name: NF1126_low_94
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_94
NF1126_low_94
[»] chr1 (2 HSPs)
chr1 (240-303)||(28850345-28850408)
chr1 (291-357)||(9502564-9502630)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 240 - 303
Target Start/End: Complemental strand, 28850408 - 28850345
Alignment:
240 aatttcctcaagcctaacccacccaaccacttcggttttgagacaacatcccacttcactgcat 303  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
28850408 aatttcctcaagcctaacccacccaaccacttcggttttcagacaacatcccacttcactgcat 28850345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 291 - 357
Target Start/End: Complemental strand, 9502630 - 9502564
Alignment:
291 cacttcactgcatccttcatcgtaaaacctatccccacactcaccgcatcctccatttccttcctac 357  Q
    |||||| || ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
9502630 cacttctctccatccttcatcgtaaaacctatctccatactcaccgcatcctccatttccttcctac 9502564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University