View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11270_high_4 (Length: 329)
Name: NF11270_high_4
Description: NF11270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11270_high_4 |
 | |
|
| [»] scaffold0114 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0114 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 5 - 316
Target Start/End: Original strand, 5675 - 5986
Alignment:
| Q |
5 |
aaataatgtcccaaaacgtcttgtaaaaatgcccaccaaacccgtctggacccggcgcactatcatcattaagatgaaaaaccgcagactttatttcaga |
104 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
5675 |
aaataatgtcccaaaatgtctagtaaaaatgcccaccaaacccgtcaggacccggcgcactatcaccattaagatcaaaaaccgcagactttatttcaga |
5774 |
T |
|
| Q |
105 |
catcacaggtaagcaacataataaatcattctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaacg |
204 |
Q |
| |
|
||||| |||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5775 |
catcataggtaaacgacataataaatcagtctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaacg |
5874 |
T |
|
| Q |
205 |
ctaaaaatagactgaaaatatgacacaacatggtcctctatctcaattgggtccgagatgacattatccccatcatgaagaatggacatatgtttagaga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
5875 |
ctaaaaatagactgaaaatatgacacaacatgctcctctatctcaattgggtccgagatgacattatccctatcatgaagaatggacatatgtttagaaa |
5974 |
T |
|
| Q |
305 |
ccgcacgtacct |
316 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5975 |
ccgcacgtacct |
5986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University