View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11270_low_1 (Length: 299)
Name: NF11270_low_1
Description: NF11270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11270_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 35768010 - 35768277
Alignment:
| Q |
16 |
acatcaacactaattactggtactttgtgggatggttggaggaaacgaagaaaagcttatatatgcgctcctcttattatatttaatcatatgctatttt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35768010 |
acatcaacactaattactggtacattgtgggatggttggaggaaacgaagaaaagcttatatttgcgctcctcttattatatttaatcatatggtatttt |
35768109 |
T |
 |
| Q |
116 |
tctttaggatttggatcatttccttttcaaacagtattattgttctttgtgttttcaaatttctgttgtcgatgcttatttctttccgacaatctctatt |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35768110 |
tcattaggatttggatcatttccttttcaaacagtattattgttctttgtgttttcaaatttctgttgtcgatgtttatttctttccgacaatctctatt |
35768209 |
T |
 |
| Q |
216 |
tctctcaattgtgtttagactcgagaaaaatatcttgagttttattttactttaatgagttttgccct |
283 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35768210 |
tctctcaactgtgtttagactcgagaaaactatcttgagttttattttactttaatgagttttgccct |
35768277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University