View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_high_42 (Length: 237)
Name: NF11271_high_42
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_high_42 |
 |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0376 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 5934 - 6155
Alignment:
| Q |
16 |
ggaacgtaatgacagatttctaatggaaaacgtgttaatgctggggaggtcgttgatcggataaaacgactgtcttggttttggttcatttagtagagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5934 |
ggaacgtaatgacagatttctaatggaaaacgtgttaatgctggggaggtcgttgatcggataaaacgactgtcttggttttggttcatttagtagagaa |
6033 |
T |
 |
| Q |
116 |
cgaaggaataagaatttagtattttcggattggtggtctagcacacttgcttgtcttgaaactgtttaaagtttgcctttatatggaattttcgtggccg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6034 |
cgaaggaataagaatttagtattttcggattggtggtctagcacacttgcttgtcttgaaactgtttaaagtttgcctttatatggaattttcgtggccg |
6133 |
T |
 |
| Q |
216 |
gtgttgtggaatttctcttagc |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6134 |
gtgttgtggaatttctcttagc |
6155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University