View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_low_13 (Length: 515)
Name: NF11271_low_13
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 2e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 275 - 502
Target Start/End: Complemental strand, 42518545 - 42518318
Alignment:
| Q |
275 |
tcaagcaggtacacgtactttactttctcgctcacaagnnnnnnnnnnnnnnnnnntctagtagacactgatggtttttatacagcagctttaagctttt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518545 |
tcaagcaggtacacgtactttactttctcgctcacaagacacacacacacacactctctagtagacactgatggtttttatacagcagctttaagctttt |
42518446 |
T |
|
| Q |
375 |
ccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaattattaccacgttat |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518445 |
ccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaattattaccacgttat |
42518346 |
T |
|
| Q |
475 |
ttgttatggacactttatttatttgtct |
502 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42518345 |
ttgttatggacactttatttatttgtct |
42518318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 20 - 112
Target Start/End: Complemental strand, 42518800 - 42518708
Alignment:
| Q |
20 |
atggtatgaacttggaatttgaaagcttacatataaaatattttagctgagaaactctatgataaaatttcagctatgcatgcatagtttaac |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518800 |
atggtttgaacttggaatttgaaagcttacatataaaatattttagctgagaaactctatgataaaatttcagctatgcatgcatagtttaac |
42518708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 185 - 217
Target Start/End: Complemental strand, 42518635 - 42518603
Alignment:
| Q |
185 |
ccatagcatgaacgacacttgtgctttttgttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42518635 |
ccatagcatgaacgacacttgtgctttttgttt |
42518603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University