View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_low_2 (Length: 940)
Name: NF11271_low_2
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_low_2 |
 | |
|
| [»] scaffold0160 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0160 (Bit Score: 579; Significance: 0; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 579; E-Value: 0
Query Start/End: Original strand, 20 - 626
Target Start/End: Original strand, 19925 - 20531
Alignment:
| Q |
20 |
tcatcgtcatcttcatcttccacgtcttcatattgttcattttgtctattccatttgtctctcgacaactgcattagacaaaatgcaacatcttcttcgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19925 |
tcatcgtcatcttcatcttccacgtcttcatattgttcattttgtctattccatttgtctctcgacaactgcattagacaaaatgcaacatcttcttcgg |
20024 |
T |
|
| Q |
120 |
ttgttgcatcagaaaccgaactaacaggttcatgttcaacaaccgaagaatcattcttattaaaaaatttcattttcttcgtagcagattcattgtaata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20025 |
ttgttgcatcagaaaccgaactaacaggttcatgttcaacaaccgaagaatcattcttgttaaaaaatttcattttcttcgtagcagattcattgtaata |
20124 |
T |
|
| Q |
220 |
cttttgatcaaacccgcgaattttccacacccttttggatcttttccgagttggattattcttcgatgattcagtttcgctttctatatcttgaagaatg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20125 |
cttttgatcaaacccgcgaattttccacacccttttggatcttttccgagttggattattcttcgatgattcagtttcgctttctatatcttgaagaatc |
20224 |
T |
|
| Q |
320 |
acggaacttgtatccacttgtggaaaagaaaactcttgatctacgagacgaatgcttctctttggattctctctaagcccataattaagacccttttcat |
419 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
20225 |
acagaacttgtatccacttgtggaaaagaaaactcttgatctacgagacgaatgcttctctttggattctctctgagaccataattaagacccttttcat |
20324 |
T |
|
| Q |
420 |
caacgtcatcatcttctgatgacgatgatgaagacggtgctgactcagcttcaaaactaagttgaaccgttcgcgatgattcttcttcttgctttgtaac |
519 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20325 |
caacgtcatcatcttctgatgacgatgatgaagacggtgctgactcagcttcaaaactaagttgaaccgttcgcgatgattcttcttcttgctttgtaac |
20424 |
T |
|
| Q |
520 |
aagaaggttcatcatgtgagatctcatgtgaccccccaatgctcttccattgttgaagcttctatagcaaagtttgcacttgtatttatccataaaagga |
619 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20425 |
aagaaggttcatcatatgagatctcatgtgaccccccaatgctcttccattgttaaagcttctatagcaaagtttgcacttgtatttatccataaaagga |
20524 |
T |
|
| Q |
620 |
tgaaact |
626 |
Q |
| |
|
||||||| |
|
|
| T |
20525 |
tgaaact |
20531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 732 - 803
Target Start/End: Complemental strand, 20818 - 20747
Alignment:
| Q |
732 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
803 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
20747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 877 - 940
Target Start/End: Complemental strand, 20674 - 20611
Alignment:
| Q |
877 |
cttagtgaagaggaatgcttgtcacctactccttttatagtctctactctctcttctttttctc |
940 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20674 |
cttagtgaagaggaatgcttgtcacctactccttttatagtttctactctctcttctttttctc |
20611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University