View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_low_32 (Length: 288)
Name: NF11271_low_32
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 11382372 - 11382522
Alignment:
| Q |
12 |
ataagcaaataagattgtccatgatcttgctaaagcggcgacaaataccgtgagtgttatgattaatgccgacgatacttagcaagataatgcttgattg |
111 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| ||| | | ||||||| |||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
11382372 |
ataaacaaataagattgttcatgatcttgctaaagtggccatatataccgttagtgttataattaatgccgatgatacttagcaagataatgtttgattg |
11382471 |
T |
 |
| Q |
112 |
ttatcgttgtacggatttataatgattatattttaattaatgaaatgctat |
162 |
Q |
| |
|
||||||||||||| | |||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11382472 |
ttatcgttgtacgaaattataatgattaaattttaattattgaaatgctat |
11382522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 182 - 277
Target Start/End: Original strand, 11382581 - 11382676
Alignment:
| Q |
182 |
atagtttgtataagctgaagtatacaaaccgagttaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttctt |
277 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11382581 |
atagtttgtataagctaaagtatgcaaaccgaattaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttctt |
11382676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University