View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_low_42 (Length: 239)
Name: NF11271_low_42
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36354080 - 36353858
Alignment:
| Q |
1 |
ttgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccagaggagagtgaatctttgcatagagctggtggatctccatggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36354080 |
ttgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccagaggagagtgaatctttgcatagagctggtggatctccatggg |
36353981 |
T |
 |
| Q |
101 |
gagtggcactcttgcttgtgttcctcttgtctatgatttcttatcagtcttcttttcatgaacgttggtttcctttcgctacaagatgaagatctaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36353980 |
gagtggcactcttgcttgtgttcctcttgtttatgatttcttatcagtcttcttttcatgaacgttggtttcctttcgctacaagatgaagatctcattc |
36353881 |
T |
 |
| Q |
201 |
tcaactagttggcatctatatag |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
36353880 |
tcaactagttggtatctatatag |
36353858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 36355366 - 36355191
Alignment:
| Q |
1 |
ttgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccagaggagagtgaatctttgcatagagctggtggatctccatggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||||| || ||| | ||||||||||||||||| ||||||| |
|
|
| T |
36355366 |
ttgttgcttgttgttcattgtctctcaagtgaaggatcgttccctttacctttgccagaggagagagagtctctacatagagctggtggatcaccatggg |
36355267 |
T |
 |
| Q |
101 |
gagtggcactcttgcttgtgttcctcttgtctatgatttcttatcagtcttcttttcatgaacgttggtttccttt |
176 |
Q |
| |
|
|||| ||||| |||||||||||||| |||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
36355266 |
gagttgcactgttgcttgtgttccttttgttcatgatggctcatcagtcttcttttcatgaacgttggtttccttt |
36355191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University