View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11271_low_49 (Length: 205)
Name: NF11271_low_49
Description: NF11271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11271_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 34826697 - 34826846
Alignment:
| Q |
17 |
cagagagacagcagccatgcgggaaaaatatcaatatcaatattcatgccatgattcttgaaagaataggcattttggtcatataacaacataagttaaa |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826697 |
cagagagatagcagccatgcgggaaaaatatcaatatcaatattcatgccatgattcttgaaagaataggcattttggtcatataacaacataagttaaa |
34826796 |
T |
 |
| Q |
117 |
ggtgagtcactttggtctctgaatatgtaatggttagtcacaatagtcct |
166 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
34826797 |
ggagagtcactttggtctccgaatatgtaatggttaatcacaatagtcct |
34826846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 165
Target Start/End: Complemental strand, 21600739 - 21600695
Alignment:
| Q |
121 |
agtcactttggtctctgaatatgtaatggttagtcacaatagtcc |
165 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
21600739 |
agtcaatttggtctctgaatgtgtaatgattagtcataatagtcc |
21600695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University