View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11273_high_11 (Length: 337)
Name: NF11273_high_11
Description: NF11273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11273_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 42471383 - 42471709
Alignment:
| Q |
1 |
ctgttgcatgataatttgtatgtggcagggaaactgtggcagattactgcaaagaagttagggaattggggttgagaatagaagaatacatatcagagag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471383 |
ctgttgcatgataatttgtatgtggcagggaaactgtggcaaattactgcaaagaagttagggaattggggttgagaatagaagaatacatatcagagag |
42471482 |
T |
 |
| Q |
101 |
cttgggcctagaaaaagattacttaaggaatgctttaggtgaacaagggcagcacatggcagtgaattactatccaccatgcccacaaccagaacttact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471483 |
cttgggcctagaaaaagattacttaaggaatgctttaggtgaacaagggcagcacatggcagtgaattactatccaccatgcccacaaccagaacttact |
42471582 |
T |
 |
| Q |
201 |
tatggattgccagggcatacagacccaaatgcacttacaattctactccaagatcttcatgttgctggcctacaagtcctcaaagatggcaagtggcttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471583 |
tatggattgccagggcatacagacccaaatgcacttacaattctactccaagatcttcatgttgctggcctacaagtcctcaaagatggcaagtggcttg |
42471682 |
T |
 |
| Q |
301 |
ctattaacccaattcctgatgcctttg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42471683 |
ctattaacccaattcctgatgcctttg |
42471709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University