View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11273_high_13 (Length: 295)

Name: NF11273_high_13
Description: NF11273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11273_high_13
NF11273_high_13
[»] chr8 (1 HSPs)
chr8 (20-282)||(3917137-3917400)


Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 282
Target Start/End: Complemental strand, 3917400 - 3917137
Alignment:
20 tatgttggggcctctgcctgggatagattgcatttagtttataaacagacaattttaacaataagctaaaaaatattacttttgttatgcagaatatcaa 119  Q
    |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3917400 tatgttggggcctctggctgggatagattgtatttagtttataaacagacaattttaacaataagctaaaaaatattacttttgttatgcagaatatcaa 3917301  T
120 aatatgacaaagtaaacttatacaaaaatatagaatatagagaaaatactctcaaaacaatctgttcaatttccttcaattcagtttggtttttgaccaa 219  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |  |||||||| |||||||| ||||||| ||||     
3917300 aatatgacaaagtaaacttatacaaaaatatagaatataaagaaaatactctcaaaacaatctgtccggtttccttcgattcagttcggtttttaaccag 3917201  T
220 aactaaaaatattggataatttttagtttgatttga-ttaatttttcgagttcatccattttct 282  Q
    |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||    
3917200 aactaaaaatattggataatttttagttcgatttgatttaatttttcgagttcatcgattttct 3917137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University