View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11273_high_18 (Length: 237)
Name: NF11273_high_18
Description: NF11273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11273_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 42471303 - 42471091
Alignment:
| Q |
1 |
tcatttgtcatgaagagccttgtcgtagctgggcttaatcaaggagactgatgagtatatgaatttttatcttccttatttttgtttattttctacgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471303 |
tcatttgtcatgaagagccttgtcgtagctgggcttaatcaaggagactgatgagtatatgaatttttatcttccttatttttgtttattttctacgaca |
42471204 |
T |
|
| Q |
101 |
aaaattaatgaagcagcaacacttacaacatccacaagagagcaccccaaattgggtgctcaaatgagtctcctaacatcacttattttacgataatagt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471203 |
aaaattaatgaagcagcaacacttagaacatccacaagagagcaccccaaattgggtgctcaaatgagtctcctaacatcacttattttacgataatagt |
42471104 |
T |
|
| Q |
201 |
taatgaacaccaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42471103 |
taatgaacaccaa |
42471091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 175
Target Start/End: Original strand, 37182379 - 37182425
Alignment:
| Q |
129 |
catccacaagagagcaccccaaattgggtgctcaaatgagtctccta |
175 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||| |||| |
|
|
| T |
37182379 |
catccacaagagagcaccccacattgggtgcttaagtgagtccccta |
37182425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University