View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11273_high_19 (Length: 222)
Name: NF11273_high_19
Description: NF11273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11273_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 23 - 177
Target Start/End: Original strand, 39299912 - 39300066
Alignment:
| Q |
23 |
agctcgtcgggccttggatccaccactgcatgtgaggtccatttcggcgagtaccggtgtttttgcagttcggtgttttttaggttagatttcgttcact |
122 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39299912 |
agctcgtcgggccttgaatctgccactgcatgtgaagtccatttcggcgagtaccagtgtttttgcagttcggtgttttttagatcagatttcgttcact |
39300011 |
T |
|
| Q |
123 |
tccacttgcaatttctttcttatttctacttggttttgttcctattcaacatttt |
177 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39300012 |
tccccttgcgatttctttcttatttctacttggttttgttcctattcaacgtttt |
39300066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 39301448 - 39301493
Alignment:
| Q |
159 |
tgttcctattcaacattttttgctctatatgttgctaactcagaag |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39301448 |
tgttcctattcagcattttttgctctatatgttgctaactcagaag |
39301493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University