View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11273_low_16 (Length: 241)
Name: NF11273_low_16
Description: NF11273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11273_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 226
Target Start/End: Complemental strand, 27100029 - 27099806
Alignment:
| Q |
3 |
tggaggagcagagagtttgttcattcatcatgcccggtctgtaaggatcttgtgttttaaatgtgctcagaactatggccacttgtattgaatcaattaa |
102 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27100029 |
tggatgagcatagagtttattcattcatcatgcccggtctgtaaggatcttgtgttttaaatgtgctcagtactatggccacttgtattgaatcaattaa |
27099930 |
T |
|
| Q |
103 |
atgtgttcagtaccctaccaacaacataaaagttgttctactcaagtttatgaaagcttctaccttagtgttaggttaccaaccaaagttgtacgtattt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27099929 |
atgtgttcagtaccctaccaacaacataaaagttgttctactcaagtttatgaaagcttctaccttagtgttaggttaccaaccaaagttgtatgtattt |
27099830 |
T |
|
| Q |
203 |
ctcataaaattagctagtgagatg |
226 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
27099829 |
ctcataaaattagcaagtgagatg |
27099806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University