View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_high_28 (Length: 388)
Name: NF11274_high_28
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 19 - 380
Target Start/End: Original strand, 43396878 - 43397239
Alignment:
| Q |
19 |
accaccccaaagagaataacataaagccggagttatcacctctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396878 |
accaccccaaagagaataacataaagccggagttatcacttctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaa |
43396977 |
T |
 |
| Q |
119 |
tccaccttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttgg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396978 |
tccaccttgggtgttgtggaaagctagaaatggtaaattttttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttgg |
43397077 |
T |
 |
| Q |
219 |
cggtggttgttgcatcatacgaagattccggtttgcctttactacgaatggtgttggaatccctatgtttgtcttgaaagggaaaggctgcgcgcctagc |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43397078 |
cggtggttgttgcatggtacgaagattccggtttgcctttactacgaatggtgttggaatccctatgcttgtcttgaaagggaaaggctgcgcgcctagc |
43397177 |
T |
 |
| Q |
319 |
ttcagttgtagttgtctgaggccggttctggtgtgtcgtgagcctgctgtcgtgtctctgct |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43397178 |
ttcagttgtagttgtctgaggccggttctggtgtgtcgtgagcctgctgtcgtgtctctgct |
43397239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 230
Target Start/End: Complemental strand, 3499446 - 3499398
Alignment:
| Q |
182 |
ggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttg |
230 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||||||| ||| ||||||| |
|
|
| T |
3499446 |
ggatgagctagtgaaggagatcaaggtgatgtcttggaggtcgttgttg |
3499398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 125 - 168
Target Start/End: Original strand, 40086943 - 40086986
Alignment:
| Q |
125 |
ttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaa |
168 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40086943 |
ttgggtattgtggaaagctaggaatgataaaatttttaatgaaa |
40086986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 277
Target Start/End: Original strand, 6495524 - 6495552
Alignment:
| Q |
249 |
gtttgcctttactacgaatggtgttggaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6495524 |
gtttgcctttactacgaatggtgttggaa |
6495552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University