View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_high_36 (Length: 340)
Name: NF11274_high_36
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 9 - 324
Target Start/End: Complemental strand, 33898487 - 33898169
Alignment:
| Q |
9 |
gacatcaacaacagcctctcgaataccaggtaaacgtttgatggctttctcaactgatccagcacaggcagcacatgtcattcccataacgcagaaaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33898487 |
gacatcaacaacagcctctcgaataccaggtaaacgtttgatggctttctcaactgatccagcacaggcagcacatgtcattcccataacgcagaaaaca |
33898388 |
T |
 |
| Q |
109 |
acagttatggccacctctgagccttctgccatcgaagacgacgttcctttcggatacgtcgtcatcgacggatagtgtgactcaggtgacaggttcccac |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33898387 |
acagttatggccacctctgagccttcacccatcgacgacgacgttcctttcggatacgtcgtcatcgacggatagtgtgactcaggtgacaggttcccac |
33898288 |
T |
 |
| Q |
209 |
agcaccgcaagtgcaatcctccatttatgcattcccaagcaccatcaaactttttatgacccattagtatcaattattattcctaatacatttat---tg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||| |||||||||||||||| || |
|
|
| T |
33898287 |
agcaccgcaagtgcaatcctccatttatgcattcccaagcaccatcaaactttttacgacccattaatatcaataattgttcctaatacatttattgatg |
33898188 |
T |
 |
| Q |
306 |
attacttttaagcactgat |
324 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33898187 |
attacttttaagcactgat |
33898169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University