View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_high_60 (Length: 239)
Name: NF11274_high_60
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_high_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 9998488 - 9998269
Alignment:
| Q |
1 |
tacaaaacatctaaccaaacatgtgttagatgtatgtttggtatcacgatggatatattatatatcagaactacggtgatttgttgtgattttgcataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9998488 |
tacaaaacatctaaccaaacatgtgttagatgtatgtttggtatcacgatggatatattatatatcagaactacggtgatttgtcgtgattttgcataag |
9998389 |
T |
 |
| Q |
101 |
ctacaacgataagtcatcataattctcacacacttaccgtgatattaaacatagaccaagagtagtgggagtgtgagaatattgatacttatctttaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9998388 |
ctacaacgataagtcatcataattctcacacacttaccgtgatatcaaacatagactaagagtagtgggagtgtgagaatattgatacttatctttaata |
9998289 |
T |
 |
| Q |
201 |
gatgagtttgacttctgtag |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9998288 |
tatgagtttgacttctgtag |
9998269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University