View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_low_25 (Length: 414)
Name: NF11274_low_25
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 406
Target Start/End: Original strand, 38002817 - 38003205
Alignment:
| Q |
17 |
acttaattgggtttaacttattattattgttatttttaagattacacaaattcatattttgttacatcatccggttcttacgaatagaatcctaataatc |
116 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38002817 |
acttaattgggtttaaattattgttattgttatttttaagattacacaaattcatgttttgttacatcatccggttcttacgaatagaatcctaataatc |
38002916 |
T |
|
| Q |
117 |
taaagttaactaaaaattacattagcccnnnnnnnnnnnnnnnnntaacataaattttgactaacgattgtttcatttgttaaaattcattaatcacttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
38002917 |
taaagttaactaaaaattacattagcccaaaaaaaaattaaaaa-taacataaattttgactaacgattgtttcacttgctaaagttcattaatcacttg |
38003015 |
T |
|
| Q |
217 |
attattttaatggcttctagatgagctaaattattctcttagcattgcttttcttttttccgcaaccatgaataggttttccccctgatttattagtgtg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38003016 |
attattttaatggcttctagatgagctaaattattctcttagcattgcttttcttttttccgcaaccatgaataggttttccccctgatttattagtgtg |
38003115 |
T |
|
| Q |
317 |
cataaaggttgctacatatggatattatggatcatgtttgataagtgataaaaagaaaaactcctttttattccactttatatctctgct |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
38003116 |
cataaaggttgctacatatggatattatggatcatgtttgataagtgataaaaagaaaaacacctttttattccactttatatctttgct |
38003205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University