View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11274_low_39 (Length: 326)

Name: NF11274_low_39
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11274_low_39
NF11274_low_39
[»] chr5 (3 HSPs)
chr5 (151-318)||(14104178-14104345)
chr5 (19-88)||(14104046-14104115)
chr5 (241-318)||(14092607-14092684)


Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 151 - 318
Target Start/End: Original strand, 14104178 - 14104345
Alignment:
151 aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggnnnnnnngggtatgctgttttgggtggttgtc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||| |||||||||    
14104178 aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggtttttttgggtatgctgttttgtgtggttgtc 14104277  T
251 ccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14104278 ccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct 14104345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 14104046 - 14104115
Alignment:
19 actcacgtgacttatgcattcttttttcctctttatttcttcttgcaaagtcagctcaagaataacatca 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14104046 actcacgtgacttatgcattcttttttcctctttatttcttcttgcaaagtcagctcaagaataacatca 14104115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 318
Target Start/End: Original strand, 14092607 - 14092684
Alignment:
241 ggtggttgtcccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct 318  Q
    ||||||||||| || ||||||| ||| ||||||||||||||||| | ||  |||||||| |||| |||||| ||||||    
14092607 ggtggttgtcctttgacttggaatgggttttctatggaggctttttctgggctttgggaatttgttaaactttctgct 14092684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University