View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_low_43 (Length: 289)
Name: NF11274_low_43
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 150 - 273
Target Start/End: Complemental strand, 48536542 - 48536414
Alignment:
| Q |
150 |
atattttagggcttacgtctcttacttcaagtggtgggccgggttaaactgtgttgcgggctatgtggcactagcag-----ttagcagtctgtgattcc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
48536542 |
atattttagggcttacgtctcttacttcaagtggtgggccgggttaaactgcgttgcgggctatgttgcactagcagtagctttagcagtctgtgattcc |
48536443 |
T |
|
| Q |
245 |
aatcccgtctgtcattccaatcccaatac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48536442 |
aatcccgtctgtcattccaatcccaatac |
48536414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 48536691 - 48536609
Alignment:
| Q |
1 |
tgtcgctgcagattcgacaaaagcgccgagcatcgatgttgaggataagcctactctagagtcgacggatctagaatgagtga |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
48536691 |
tgtcgctgcagattcgacgaaagcgccgagcatcgatgttgaggataagcctactctagagtcggcggatctagagtgagtga |
48536609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 48533715 - 48533671
Alignment:
| Q |
1 |
tgtcgctgcagattcgacaaaagcgccgagcatcgatgttgagga |
45 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
48533715 |
tgtcgctgcagattcgacggaagcgccgagcatcaatgtcgagga |
48533671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University