View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_low_48 (Length: 254)
Name: NF11274_low_48
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 5 - 170
Target Start/End: Original strand, 46159435 - 46159600
Alignment:
| Q |
5 |
tgaaaaatcaatgttaaacatatctatacacaaaggacaacatactgaaaatcaaacataaaatgaggaaaatgaagcttctgtttccacttatctatga |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
46159435 |
tgaaaagtcaatgttaaacatatctatacacaaaggacaacatactgaaaatcaaacataaaatgaggaaaatgaagcttctgtttcaactcatctatga |
46159534 |
T |
 |
| Q |
105 |
ttgattatgcatgttctgaaaagaggtgcaaaggcctggggagccgagctagcatagtggtgcaaa |
170 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
46159535 |
ttgattatgcatgttcagaaaagaggtgcaaaggcctgtggagctgagctagcatagtggtgcaaa |
46159600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 165 - 239
Target Start/End: Original strand, 46159679 - 46159753
Alignment:
| Q |
165 |
tgcaaactgtttgttactggggcgacaacccccgcagtactgctccagagtattgttgtaatccgaaccgtaact |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46159679 |
tgcaaactgtttgttacgggggcgacaacccccgcagtactgctccagagtattgttgtaatccgaaccgtaact |
46159753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 170
Target Start/End: Original strand, 46159593 - 46159634
Alignment:
| Q |
129 |
ggtgcaaaggcctggggagccgagctagcatagtggtgcaaa |
170 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46159593 |
ggtgcaaaggcctggggagctgagctagcatagtggtgcaaa |
46159634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 160
Target Start/End: Original strand, 46166446 - 46166519
Alignment:
| Q |
88 |
tttccacttatctatgattgattatgcatgttc-tgaaaagaggtgcaaaggcctggggagccgagctagcata |
160 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||| | | |||||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
46166446 |
tttcaactcatctatgattaattatgcatgtgcataaaaagaggggcaaaggcatggggggctgagctagcata |
46166519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University