View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_low_49 (Length: 253)
Name: NF11274_low_49
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_low_49 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 329212 - 329445
Alignment:
| Q |
18 |
aataattacattcaaaattaatcttgcagagctgacatttggtcatttggcataactgcattggagcttgcccatggccatgctcctttctcaaaatatc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329212 |
aataatgacattcaaaattaatcttgcagagctgacatttggtcatttggcataactgcattggagcttgcccatggccatgctcctttctcaaaatatc |
329311 |
T |
|
| Q |
118 |
caccattgaaggtgtgtgtgcacatactatcatagtatttgctataagcactcaaaattttattccatttttctttgtttaatttcataataattaaact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
329312 |
caccattgaaggtgtgtgtgcacatactatcatagtatttgctataagcactcaaaattttatcccatttttc--tgtttaatttcataataattaaact |
329409 |
T |
|
| Q |
218 |
ttccaggtactgcttatgactttgcaaaatgcacct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
329410 |
ttccaggtactgcttatgactttgcaaaatgcacct |
329445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University