View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11274_low_65 (Length: 231)
Name: NF11274_low_65
Description: NF11274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11274_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 14806840 - 14806650
Alignment:
| Q |
1 |
tagattatagattaaaggtttctttgatgtctcannnnnnnngcttttgcacactttgcgggtcatttcaatggtaccataatatcatataaagctggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14806840 |
tagattatagattaaaggtttctttgatgtctcattttttttgcttttgcacactttgcgggtcatttcaatggttccataatatcatataaagctggaa |
14806741 |
T |
|
| Q |
101 |
attttcagtaatatgcaggtctgcagtgctggtgtacatgtgtccttgcagcagttaaactttcttgtaccccaagctccttatttcttta |
191 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14806740 |
agtttcagtaatatgcaggtctgcagtgctggtgtacatgtgtccttgcagcagttaaactttcttgcaccccaagctccttatttcttta |
14806650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University