View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11276_high_23 (Length: 240)
Name: NF11276_high_23
Description: NF11276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11276_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 2726903 - 2726696
Alignment:
| Q |
16 |
gacaggaaagacattgttagcaaaagcaattgcaggagaagcaaaagttccattcttttctctatctggttcagagttcatcgagatgtttgtcggtgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2726903 |
gacaggaaagacattgttagcaaaagcaattgcaggagaagcaaaagttccattcttttctctatctggttcagagttcatcgagatgtttgtcggtgtt |
2726804 |
T |
 |
| Q |
116 |
ggagcttcaagagtgagagatttgtttaataaggcaaaagaaaattcaccttgtttggtatttattgatgagatagatgctgtagggagacagagaggta |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2726803 |
ggtgcttcaagagtgagagatttgtttaataaggcaaaagaaaattcaccttgtttggtatttattgatgagatagatgctgtagggagacagagaggta |
2726704 |
T |
 |
| Q |
216 |
ctggtatt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
2726703 |
ctggtatt |
2726696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 53796476 - 53796513
Alignment:
| Q |
176 |
tttattgatgagatagatgctgtagggagacagagagg |
213 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
53796476 |
tttattgatgagattgatgctgttgggagacagagagg |
53796513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University