View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11276_low_17 (Length: 315)
Name: NF11276_low_17
Description: NF11276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11276_low_17 |
 |  |
|
| [»] scaffold0286 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0286 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: scaffold0286
Description:
Target: scaffold0286; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 12894 - 13044
Alignment:
| Q |
19 |
agggttgcatagaggaagcattggttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatattcgattcaccaatccgtatgaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894 |
agggttgcatagaggaagcattggttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatattcgattcaccaatccgtatgaatg |
12993 |
T |
 |
| Q |
119 |
agaaaattagatgaagactcaatagttcgctatcacaattccacccgcatc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12994 |
agaaaattagatgaagactcaatagttctctatcacaattccacccgcatc |
13044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0286; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 305
Target Start/End: Original strand, 13132 - 13181
Alignment:
| Q |
256 |
gtcccctgagttcctgtagggcacagacttgtatgtagcttttccctttg |
305 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13132 |
gtcccccgagttcctgtagggcacagacttgtatgtagcttttctctttg |
13181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 19 - 169
Target Start/End: Complemental strand, 2170367 - 2170217
Alignment:
| Q |
19 |
agggttgcatagaggaagcattggttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatattcgattcaccaatccgtatgaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170367 |
agggttgcatagaggaagcattggttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatattcgattcaccaatccgtatgaatg |
2170268 |
T |
 |
| Q |
119 |
agaaaattagatgaagactcaatagttcgctatcacaattccacccgcatc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2170267 |
agaaaattagatgaagactcaatagttctctatcacaattccacccgcatc |
2170217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 29 - 123
Target Start/End: Original strand, 2188263 - 2188357
Alignment:
| Q |
29 |
agaggaagcattggttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatattcgattcaccaatccgtatgaatgagaaa |
123 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
2188263 |
agaggaagaattgtttatagaaagtggagttcacgtattcaagctgaaaactagtatggaggatattcgatttaccaatccgcataattgagaaa |
2188357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 256 - 305
Target Start/End: Complemental strand, 2170130 - 2170081
Alignment:
| Q |
256 |
gtcccctgagttcctgtagggcacagacttgtatgtagcttttccctttg |
305 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2170130 |
gtcccccgagttcctgtagggcacagacttgtatgtagcttttctctttg |
2170081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 16694585 - 16694636
Alignment:
| Q |
43 |
ttatagaaagtggaattcacgtattcaagctgaaaagtagtatggaggatat |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
16694585 |
ttatagaaagtggaattcacttattcaagcagaaaagtagcatggaggatat |
16694636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University