View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11276_low_18 (Length: 300)
Name: NF11276_low_18
Description: NF11276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11276_low_18 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 22 - 284
Target Start/End: Original strand, 10100 - 10362
Alignment:
| Q |
22 |
gtggaacattggaagtaaacttgtgttctttatcatgcttaattcgtagcatcaatcaacttgctctacaagccaagatgatggtgtaaacccttgaagt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10100 |
gtggaacattggaagtaaacttgtgttctttatcatgcttaattcgtagcatcaatcaacttgctctacaagccaagatgatggtgtaaacccttgaagt |
10199 |
T |
 |
| Q |
122 |
aacggaaaatccaagacaacatagcaagtacaacaataccaaacccacaagtgaacaaaaaacccacaatgaaaacaaagagaacggcgaaaaccggaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10200 |
aacggaaaatccaagacaacatagcaagtacaacaataccaaacccacaagtgaacaaaaagcccacaatgaaaacaaagagaacggcgaaaaccggaac |
10299 |
T |
 |
| Q |
222 |
caatattgggcttaaaaagatgatcattggcgcaaagaggataaaacccatgatggttactac |
284 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300 |
caatattgggcttaacaagatgatcattggcgcaaagaggataaaacccatgatggttactac |
10362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University