View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11276_low_26 (Length: 209)
Name: NF11276_low_26
Description: NF11276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11276_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 65 - 184
Target Start/End: Complemental strand, 3763802 - 3763683
Alignment:
| Q |
65 |
ctctctacttctttataatgatgcatgtgagtcactaaaatgacgcaaccatgatcatgagccaacaaccacgccacacacccattctgattcagccatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3763802 |
ctctctacttctttataatgatgcatgtgagtcactaaaatgacgcaaccatgatcatgagccaacaaccacgccatacacccattctgattcagccatt |
3763703 |
T |
 |
| Q |
165 |
gaatggaaccaaatgatata |
184 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3763702 |
gaatggaaccaaatgatata |
3763683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 163
Target Start/End: Complemental strand, 3775699 - 3775616
Alignment:
| Q |
73 |
ttctttataatgatgcatgtgagtcactaaaatgacgcaaccatgatcatgagccaacaaccacgccacacacccattctgattcagccat |
163 |
Q |
| |
|
||||||||| ||||||||| |||||| | ||||||||||| ||||||||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
3775699 |
ttctttata-tgatgcatgcgagtcaatgaaatgacgcaa------tcatgagccaacaactacgccacacacctattcagattcagccat |
3775616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University