View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11276_low_9 (Length: 452)
Name: NF11276_low_9
Description: NF11276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11276_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 18 - 445
Target Start/End: Complemental strand, 30160925 - 30160500
Alignment:
| Q |
18 |
atcataagttgttttcatgcactctcacaagtgtttatgccaactgataaactgaaatttgtcaatccaagaaggcccaatgtcttatatgggatagttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30160925 |
atcataagttgttttcatgcactctcacaagtgtttatgccaactgatagactgaaatttgtcaatccaagaaggcccaatgtcttatatgggatagttt |
30160826 |
T |
 |
| Q |
118 |
attctgtccatgacaattgcataatttaggttttaattaagggatccctcattaggtaagtgatttgtaatctcacactgattatttgccatggcaatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30160825 |
attctgtccatgacaattgcataatttaggttttaattaagggatccctcattaggtaagtgatttgtaatc--acactgattatttgccatggcaatgg |
30160728 |
T |
 |
| Q |
218 |
aatggggagagactatcctcaccttgaactttactatgtcaattaataataaaaggcgctttatatgggataactgagtttccttatttgttatcttgca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30160727 |
aatggggagagactatcctcaccttgaactttactatgtcaatcaataataaaaggcgctttatatgggataactgagtttccttattggttatcttgca |
30160628 |
T |
 |
| Q |
318 |
gtcctttctgatagtatcggatccagctattgcaaaacacatattgaaagacaattcaaaggcttattctaaggtaatcaaatcaatagtcaacaatgat |
417 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30160627 |
gtcctttctgatagtatcggatccggctattgcaaaacacatattgaaagacaattcaaaggcttattctaaggtaatcaaatcaatagtcaacaatgat |
30160528 |
T |
 |
| Q |
418 |
tggtattgtgcaattgtttttcttctct |
445 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
30160527 |
tggtattgtgcaattgtttttctgctct |
30160500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University