View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11277_high_3 (Length: 216)
Name: NF11277_high_3
Description: NF11277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11277_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 244454 - 244268
Alignment:
| Q |
15 |
aagaagaacgagaacgaccaaaagtacaaccttggagaggagcttcattatccatttccatcaacactttgtaaaagacatcaacattacaaggaagagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
244454 |
aagaagaacgagaacgaccaaaagtacaaccttggagaggagcttcattatccatttccatcaacactttgtaaaagacatcaacattacaaggaagagc |
244355 |
T |
 |
| Q |
115 |
caaaggtccttggcagctataaccatattctgattcagcttcttcaagcaacatcttgaacaaaggatgattagcatactcagtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
244354 |
caaaggtccttggcagctataaccatattctgattcagcttcttcaagcaacatcttgaacaaaggatgattagcatactcagtttt |
244268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University