View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_100 (Length: 291)
Name: NF11278_high_100
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_100 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 126 - 206
Target Start/End: Original strand, 19252670 - 19252747
Alignment:
| Q |
126 |
gttgtcaccttatcctttttcaggtacccttttaccaacaacaatggcttgttgttgacttgttcttcccatttccgtacg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19252670 |
gttgtcaccttatcctttttcaggtacccttttaccaacaacaatggc---ttgttgacttgttcttcccatttccgtacg |
19252747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 11 - 74
Target Start/End: Original strand, 19252555 - 19252618
Alignment:
| Q |
11 |
cacagacattatctcatacaactacactcaccaccttgtcttccctcaatattcctataaaccc |
74 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19252555 |
cacacacattatctcatacaactacactcaccaccttgtcttccctcaatattcctataaaccc |
19252618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University