View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_high_118 (Length: 254)

Name: NF11278_high_118
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_high_118
NF11278_high_118
[»] chr6 (1 HSPs)
chr6 (18-245)||(7325777-7325997)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 7325777 - 7325997
Alignment:
18 tattccattagtgggactagatggaggcaaatgataataccataatggtacaactatagaaaccttataagattgcatgctctaaatgagggcaagaatt 117  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||| ||||||||||||  ||||||||||||||||||||||||||||    
7325777 tattccattagtgggactagatggaggcaaatggtaacaccataatggtacaattatggaaaccttataaagttgcatgctctaaatgagggcaagaatt 7325876  T
118 ttctcaagaggacggagaagcacacttc-ggggtagaagaaggtgtggtatctatcttcttgnnnnnnnnnnnnnattaaggtccaaattaattgtcgta 216  Q
    |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||              | ||||||||||||||||||||||     
7325877 ttctcaagaggacggagaagcacacttcaggggtagaagacggtgtggtatctatcttctt--------ttttttactaaggtccaaattaattgtcgtt 7325968  T
217 aaggaaaaataaataaacctatttgtatt 245  Q
    |||||||||||||||||||||||||||||    
7325969 aaggaaaaataaataaacctatttgtatt 7325997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University