View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_124 (Length: 251)
Name: NF11278_high_124
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_124 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 14193064 - 14193294
Alignment:
| Q |
19 |
cttctagctgctgggataatcatcattccagtac---gccaggtgcnnnnnnntccggaggtaattgatttgacggatacattcgactttaatataagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||| ||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14193064 |
cttctagctgctgggataatcatcattccagtaccctgcctggtggaacgaaatccccaggtacttgatttgacggatacattcgactttaatatacgtt |
14193163 |
T |
 |
| Q |
116 |
ttgacgataca---gggaagctaggaatcccggtgttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaat |
212 |
Q |
| |
|
| ||| ||| | ||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193164 |
tggactatataacgggggagctacgaatcccggtgttgaatttcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaat |
14193263 |
T |
 |
| Q |
213 |
taacattaaatgcaaatatacatcctatgct |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
14193264 |
taacattagatgcaaatatacatcctatgct |
14193294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 205
Target Start/End: Original strand, 18521891 - 18521949
Alignment:
| Q |
147 |
gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcaga |
205 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18521891 |
gttgtatgttaaggaaacaacggaagtgaagtggaggaatttgattgcttgggaacaga |
18521949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 160 - 242
Target Start/End: Original strand, 4591407 - 4591489
Alignment:
| Q |
160 |
gaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||| | |||| ||||||||| ||||||||||| |
|
|
| T |
4591407 |
gaaacaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaaattggattagatgcaaatacacatcctatgc |
4591489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 157 - 242
Target Start/End: Original strand, 4555103 - 4555188
Alignment:
| Q |
157 |
aaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc |
242 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| | |||||||||||| || |||||||| |
|
|
| T |
4555103 |
aaggaaagaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaatttggagtaaatgcaaatacacttcctatgc |
4555188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 4620934 - 4620992
Alignment:
| Q |
155 |
tcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatt |
213 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4620934 |
tcaaggaaacaactgaagttaagtggaggaatttgattgcttgggagcaaagcaaaatt |
4620992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University