View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_133 (Length: 249)
Name: NF11278_high_133
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_133 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 501964 - 502203
Alignment:
| Q |
1 |
aacaaaatgttgtttatgaattatttgatttaattttgtgtaggatttgtcatcttgttattatggatgtggagatcatgcatttgaaatggagcagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
501964 |
aacaaaatgttgtttatgaattatttgattt-----tgtgtaggatttgtcatcttgttattatggatgtggagatcatgcatttgaaatggagcagaag |
502058 |
T |
|
| Q |
101 |
aacacactaccaacacagagaatgtcag------tttcagatcacatgaatggatttcaatatcaaaccgagaaattcgatagctatgtgattgacatgg |
194 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
502059 |
aacacac---caacacagagaatgtcagtttcagtttcagatcacatgaatggatttcaatatccaaccgagaaattcgatagctatgtgattgacatgg |
502155 |
T |
|
| Q |
195 |
atcccgccttctcttcaggcatcaacaaagatagtagtgcctatgcta |
242 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
502156 |
atgccgccttctcttcaggcatcaacaaagatagtagtgccaatgcta |
502203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University