View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_145 (Length: 242)
Name: NF11278_high_145
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_145 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 42687074 - 42687288
Alignment:
| Q |
12 |
acagaaaagctggagtaatggaagcaacctg------tctaagtaaataagtcagacactgtaacctagactggcagcgagagcacgttattcagcttct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42687074 |
acagaaaagctggagtaatggaagcaacctgaagatctctaagtaaataagtcagacactgtaacctagactggcagcgagagcacgatattcagcttct |
42687173 |
T |
 |
| Q |
106 |
gttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagacgcagtatcctgtgacagatcttcgagaagtaggg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42687174 |
gttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagatgcagtatcctgtgacagatcttcgagaagtaggg |
42687273 |
T |
 |
| Q |
206 |
caagtagccctatcg |
220 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
42687274 |
caggtagccctatcg |
42687288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University