View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_high_146 (Length: 241)

Name: NF11278_high_146
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_high_146
NF11278_high_146
[»] chr5 (1 HSPs)
chr5 (1-222)||(25029802-25030024)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25029802 - 25030024
Alignment:
1 tatgtcccatggctgcagctacggttggatggactttgattctttaaaatttgtggcagcaaaactgacagcccctacattgttctggaaacaaacagaa 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
25029802 tatgtcccatggttgcagctacggttggatggactttgattctttaaaatttgtggcagcaaaactgacagcccgtacattgttctggaaacaaacagaa 25029901  T
101 aacacatatccatttaaattgcaatcagtgtcctccactttgtccagtcgatatcctgcccagcccca-ctagcgctaaccatgacttgctgccctctac 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
25029902 aacacatatccatttaaattgcaatcagtgtcctccactttgtccagtcgatatcctgcccagccccacctagcgctaaccatgacttgctgccctctac 25030001  T
200 actctatatcttaaaacaaattt 222  Q
    | |||||||||||||||||||||    
25030002 attctatatcttaaaacaaattt 25030024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University