View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_high_154 (Length: 230)

Name: NF11278_high_154
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_high_154
NF11278_high_154
[»] chr5 (2 HSPs)
chr5 (46-150)||(2230425-2230529)
chr5 (164-206)||(2230366-2230408)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 2230529 - 2230425
Alignment:
46 agatatatgcagagtggaaagtgaagggaattttcgggctagaggatggcatcgatgagtttgtacgagaaccgagtgaagaaggaccaaaaatatggag 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2230529 agatatatgcagagtggaaagtgaagggaattttcgggctagaggatggcatcgatgaatttgtacgagaaccgagtgaagaaggaccaaaaatatggag 2230430  T
146 atcaa 150  Q
    |||||    
2230429 atcaa 2230425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 2230408 - 2230366
Alignment:
164 aaaatagagaaatcaagtgtgcttttgaacctatttttaattt 206  Q
    |||||||||||||||||||| ||||||| ||||||||||||||    
2230408 aaaatagagaaatcaagtgtacttttgagcctatttttaattt 2230366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University