View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_157 (Length: 228)
Name: NF11278_high_157
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_157 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 71 - 212
Target Start/End: Original strand, 46230572 - 46230714
Alignment:
| Q |
71 |
catgtgaaatgtcgtctttattagtgtgattgtgatcgttaattagcacaaagaggtaacgatcattttgattatccaattggattgctgaaataacttt |
170 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46230572 |
catgtgaaatgtcttctttattagtgtgattgtgatcgttaattagcacaaaggcgtaacgatcattttgattatccaattggattgctgaaataacttt |
46230671 |
T |
 |
| Q |
171 |
tgctgta-nnnnnnnnncctaagaaattgccttatgtatgatg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
46230672 |
tgctgtattttttttttcctaagaaattgccttatgtatgatg |
46230714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University