View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_161 (Length: 227)
Name: NF11278_high_161
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_161 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 29764165 - 29763957
Alignment:
| Q |
19 |
aagaaagtgccaaaaatgtgtcacacttagaatagttcttctagtctagatagcaaaagacaaaaatttaatggaccacacactatgtcatatgatagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29764165 |
aagaaagtgccaaaaatgtgtcacacttagaatagttcttctagtctagatagcaaaagacaaaaatttaatggaccacacactatgtcatatgatagag |
29764066 |
T |
|
| Q |
119 |
ttggtgtgtgaatgcaggaataaaacaaaagtgtgtcacgataaagttgtttttgtgaatcaaaggtttaggtgtttaattaaatagcaatgatatttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
29764065 |
ttggtgtgtgaatgcaggaataaaacaaaagtgtgtcacgataaagttgtttttgtgaatcaaaggtttaggtgtttaattaaagagtaatgatatttgt |
29763966 |
T |
|
| Q |
219 |
acatccatt |
227 |
Q |
| |
|
|||| |||| |
|
|
| T |
29763965 |
acattcatt |
29763957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University