View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_164 (Length: 211)
Name: NF11278_high_164
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_164 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 24 - 211
Target Start/End: Complemental strand, 5861559 - 5861391
Alignment:
| Q |
24 |
acacacacatactcatgcaacatggcttcaatcacttccgtcgaactcaactatctcgtatttcgttaccttcaagaatcaggttacttccttctctttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5861559 |
acacacacatactcatgcaacatggcttcaatcacttccgtcgaactcaactatctcgtatttcgttaccttcaagaatcaggttacttccttctctttt |
5861460 |
T |
 |
| Q |
124 |
gtttcatcttcaatttcgttattatgcttttatttcgttcttctttggtctttttcagtcaaccaaatgtcaagggcttagactttat |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5861459 |
gtttcatcttcaattt-------------------cgttcttctttggtctttttcagtcaaccaaatgtcaagggcttagactttat |
5861391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 42 - 107
Target Start/End: Complemental strand, 5873970 - 5873905
Alignment:
| Q |
42 |
aacatggcttcaatcacttccgtcgaactcaactatctcgtatttcgttaccttcaagaatcaggt |
107 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
5873970 |
aacatggcttccatcacctccgtcgaactcaattatctcgtctttcgctaccttcaagaatcaggt |
5873905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 5873841 - 5873802
Alignment:
| Q |
172 |
tctttttcagtcaaccaaatgtcaagggcttagactttat |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5873841 |
tctttttcggtcaaccaaatgtcaagggtttagactttat |
5873802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 108
Target Start/End: Original strand, 39607878 - 39607942
Alignment:
| Q |
44 |
catggcttcaatcacttccgtcgaactcaactatctcgtatttcgttaccttcaagaatcaggtt |
108 |
Q |
| |
|
|||||| || ||||| |||||||||||||||| |||| | ||||||||||| | |||||||||| |
|
|
| T |
39607878 |
catggcctccatcacctccgtcgaactcaactttctcatttttcgttacctcaacgaatcaggtt |
39607942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University