View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_166 (Length: 207)
Name: NF11278_high_166
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_166 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 30480640 - 30480815
Alignment:
| Q |
20 |
cccctggctttcgattttaccctagtgatgaagagttggtccttcattacctttacnnnnnnntcactaatgaggatgttcttaagggtaccttggagga |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480640 |
cccctggctttcgattttaccccagtgatgaagagttggtccttcattacctttacaaaaaaatcactaatgaggatgttcttaagggtaccttggagga |
30480739 |
T |
|
| Q |
120 |
aattgacttgcatacttgcgagccttggcaacttcctggtatatattatatttatcatcattttcacttcatctct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30480740 |
aattgacttgcatacttgcgagccttggcaacttcctggtatatattatatttatcatcattttcacttcatctct |
30480815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University