View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_high_67 (Length: 372)
Name: NF11278_high_67
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 73 - 238
Target Start/End: Original strand, 43372941 - 43373107
Alignment:
| Q |
73 |
tgttgcaaagaaagattaaatt-taaaagcatattcatgatattcagatattgtatgcatgcgtcttcctaatacgtttatgaaattgtaggcattggta |
171 |
Q |
| |
|
|||| ||||||| ||||| ||| ||||| ||||||| |||||||||||||||||||||| | |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43372941 |
tgtttcaaagaatgattacattctaaaatcatattcttgatattcagatattgtatgcacacttcttcctaatacatttatgaaattgcaggcattggta |
43373040 |
T |
 |
| Q |
172 |
atcattgagcagtctttttattttccttactgaagtattactttaagttaggtataaccggtgcagc |
238 |
Q |
| |
|
||| || ||| |||||||||||| ||||||| | ||||||||||||||| ||| || |||||||||| |
|
|
| T |
43373041 |
atctttcagcggtctttttatttcccttacttatgtattactttaagttgggtgtagccggtgcagc |
43373107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 285 - 338
Target Start/End: Original strand, 43373194 - 43373248
Alignment:
| Q |
285 |
ctctagttatgatggaacttttgtgtctcagatatatt-ggaccttgttgatgat |
338 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
43373194 |
ctctaattatgatggaactttcatgtctcagatatattgggaccttgttgatgat |
43373248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 53 - 143
Target Start/End: Complemental strand, 3420301 - 3420211
Alignment:
| Q |
53 |
gttcctaatagtctttcatttgttgcaaagaaagattaaatttaaaagcatattcatgatattcagatattgtatgcatgcgtcttcctaa |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3420301 |
gttcctaatagtctttcatttgtttcaaagaaagatcaaatttaaaagcatattcatgatattcagatattgtatgcatgtgtcttcctaa |
3420211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 205 - 283
Target Start/End: Original strand, 3739929 - 3740007
Alignment:
| Q |
205 |
agtattactttaagttaggtataaccggtgcagcaattcagtatgacctctttcaaattcattcttttctttctctatt |
283 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
3739929 |
agtattactttaagctaggtataaccggtgcagccattcagcatgacctctttcaaatgcattcttttctttgtctatt |
3740007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 285 - 345
Target Start/End: Original strand, 3740035 - 3740095
Alignment:
| Q |
285 |
ctctagttatgatggaacttttgtgtctcagatatattggaccttgttgatgatttggggt |
345 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
3740035 |
ctctaattatgatggaactttaatgtctcatatatattggaccttgtcgatgatatggggt |
3740095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University