View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11278_low_100 (Length: 298)
Name: NF11278_low_100
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11278_low_100 |
 |  |
|
| [»] scaffold0687 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 48253373 - 48253226
Alignment:
| Q |
20 |
gtggtggtggttgttgttgtcgtcgccgcaacagtggtggttgagtttgcggcgtttgtggttgattgagcggtttcagaaccgaaaatgggggatttaa |
119 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48253373 |
gtggtggtggttgttgttgttgttgtcgcaacagtggtggttgagtttacggctgttgtggttgattgaggggtttcagaaccgaaaatgggggatttaa |
48253274 |
T |
 |
| Q |
120 |
aagggttaaagagattaggatgaattactctttcttctatgttgtggt |
167 |
Q |
| |
|
| ||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48253273 |
aggggttaagaagattaggatgaattattctttcttctatgttgtggt |
48253226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 20 - 159
Target Start/End: Original strand, 29665234 - 29665373
Alignment:
| Q |
20 |
gtggtggtggttgttgttgtcgtcgccgcaacagtggtggttgagtttgcggcgtttgtggttgattgagcggtttcagaaccgaaaatgggggatttaa |
119 |
Q |
| |
|
|||||||||||||||||||| || | | |||||||||||||||| ||||||||| ||||||||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
29665234 |
gtggtggtggttgttgttgttgttgtcacaacagtggtggttgattttgcggcggttgtggttgattgaggagtttcataattgaaaatgggggatttaa |
29665333 |
T |
 |
| Q |
120 |
aagggttaaagagattaggatgaattactctttcttctat |
159 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29665334 |
aggggttaaagagattaggatgaattattctttcttctat |
29665373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 6615219 - 6615160
Alignment:
| Q |
125 |
ttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactca |
185 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6615219 |
ttaaagagattaggatgaatt-ctttttcttctctgttgtggtgactgttgatggaactca |
6615160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 186
Target Start/End: Complemental strand, 47667593 - 47667540
Alignment:
| Q |
132 |
gattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
|||||||||||||| || |||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
47667593 |
gattaggatgaatt-ctttttcttctctgttatggtgactgttgatggaactcag |
47667540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 45090004 - 45089851
Alignment:
| Q |
20 |
gtggtggtggttgttgttgtcgtcgccgcaacagtggtggttgagtttgcggcgtttgtggttgattgagcggtttcagaaccgaaaatgggggatttaa |
119 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45090004 |
gtggtggttgttgtcgtcgtcgtcgccgcaacagtggtggttgagtttgcggcgtttgtggttgattgaggggtt-----------aatgggggatttaa |
45089916 |
T |
 |
| Q |
120 |
aagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
| |||||||||||||||||| |||||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
45089915 |
aggggttaaagagattaggaagaattattctttcttctgtgttgtggtgac--ttgatggaactcag |
45089851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 94 - 186
Target Start/End: Original strand, 39516138 - 39516230
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39516138 |
ttcagaaccaaaaatggggggtttaaagggattaaagagattaggatgaattcttctttcttctttgttgtggtgactgttgatggaactcag |
39516230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 186
Target Start/End: Complemental strand, 7796207 - 7796115
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||||| ||||||||||||| |||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
7796207 |
ttcagaaccaaaaatggggggtttaaagggattaaagaaattaggatgaattgttctttcttctctgttatggtgactgttgatggaactcag |
7796115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 186
Target Start/End: Complemental strand, 7815483 - 7815391
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||||| ||||||||||||| |||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
7815483 |
ttcagaaccaaaaatggggggtttaaagggattaaagaaattaggatgaattgttctttcttctctgttatggtgactgttgatggaactcag |
7815391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 94 - 169
Target Start/End: Complemental strand, 24068801 - 24068726
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtga |
169 |
Q |
| |
|
|||||||||||||||||||| |||||| | |||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
24068801 |
ttcagaaccgaaaatggggggtttaaaggaattaaagagattaggatgaattattctttcttctctgttgtggtga |
24068726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 94 - 186
Target Start/End: Complemental strand, 7770426 - 7770334
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
||||||||| |||||||| | |||||| || ||||||| ||||||||||||| |||||||||| |||| ||| ||| ||||||||||||||| |
|
|
| T |
7770426 |
ttcagaaccaaaaatgggaggtttaaagggattaaagaaattaggatgaattgttctttcttctctgttatggagactgttgatggaactcag |
7770334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 186
Target Start/End: Original strand, 6240 - 6332
Alignment:
| Q |
94 |
ttcagaaccgaaaatgggggatttaaaagggttaaagagattaggatgaattactctttcttctatgttgtggtgaccgttgatggaactcag |
186 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||||| ||||||||||||| |||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
6240 |
ttcagaaccaaaaatggggggtttaaagggattaaagaaattaggatgaattgttctttcttctctgttatggtgactgttgatggaactcag |
6332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University